Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 91211345 91220355 enh13380

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 91220036 rs553128270 A AAGACTCATAATATAGATGAGTCTTAC 1567649

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results