EnhancerDB
  1. Home
  2. TFBS
  3. SPDEF[chr10:91425644-91425655]
Chromosome characteristics of SPDEF[chr10:91425644-91425655]
Back to top
Enhancers possibly regulated by SPDEF[chr10:91425644-91425655]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 91422076 91426152 enh43363
Muscle (Myotube)
SNP sites on SPDEF[chr10:91425644-91425655]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 91425648 rs370447051 A ATCCTGGTTGTGCCACTCACT 1568797
chr10 91425648 rs564383155 A ATCCTGGTTGTGCCACTCACT 1568798
Genes possibly regulated by SPDEF[chr10:91425644-91425655]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by SPDEF[chr10:91425644-91425655]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results