Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 92171005 92181235 enh13389

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 92179398 rs559664815 ACTAAGATCTCTTCCAAAGT A 1572561

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results