Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 93298252 93304575 enh74648

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 93303059 rs538203890 CAGGAAGGAAGGGAGGGAGGAAGGG C 1577720
chr10 93303063 rs574507796 A G 1577721

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results