Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 99009545 99013695 enh1453

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 99012193 rs569362720 CATGGTGAAACCCCGTCTCTACTAAAAAT C 1603347
chr10 99012204 rs547330272 C A,T 1603348

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results