Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 99520685 99526495 enh60270

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 99522764 rs566072979 CCTCCGGCCTGGTCGGGTATGTTTCAA C 1605877

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results