Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 100236664 100240834 enh86882

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 100237634 rs545265414 TC T 1609304
chr10 100237639 rs569709808 G T 1609305
chr10 100237640 rs536116878 A AGTATATATATACTATATATATATAT 1609306

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results