Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 99886525 99895155 enh106551

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 99894847 rs562423416 ATGTATATATATACACATATATATATG A 9980743

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results