Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 101176649 101180967 enh116012

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 101178049 rs368886404 GTGTGGCTTGGAGTCAGACATT G 9986625
chr7 101178049 rs375430691 GTGTGGCTTGGAGTCAGACATT G 9986626

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results