Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 101901994 101910055 enh9958

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 101905709 rs55973199 T TG,TGGATGGATGGAC,TGGATGGATGGATGGATGGAT 9993047

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results