Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 107454425 107458575 enh114625

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 107457624 rs536922529 TCCCAAAGTGCTGGGATTACAGGCGTGAGCCA T 10015755

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results