EnhancerDB
  1. Home
  2. TFBS
  3. POU5F1B[chr7:107887999-107888008]
Chromosome characteristics of POU5F1B[chr7:107887999-107888008]
Back to top
Enhancers possibly regulated by POU5F1B[chr7:107887999-107888008]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 107882665 107896935 enh40471
Bone Marrow (K562) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Astrocyte Bone (Osteoblast) Lung (PC-9) Muscle (Myoblast) Spleen Muscle (Myotube) Epithelial (MCF-7)
SNP sites on POU5F1B[chr7:107887999-107888008]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 107888004 rs16872465 G C 10017704
chr7 107888005 rs560660456 CATAAATTTGTTTATGCTAAATTATTTTAG C 10017705
Genes possibly regulated by POU5F1B[chr7:107887999-107888008]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by POU5F1B[chr7:107887999-107888008]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results