Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 108167865 108180955 enh9985

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 108178954 rs370017429 ACAGTGGTGAAGGGAAATCTTCCCACTGGG A 10019742
chr7 108178954 rs575930981 ACAGTGGTGAAGGGAAATCTTCCCACTGGG A 10019743

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results