Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 135049985 135054135 enh56504

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 135051556 rs557683553 TGGCACAAAGAAAAGGTGAGAGAAAG T 10114821

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results