Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 135333589 135338055 enh24553

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 135336556 rs11271348 G GCCTGGGCAACAGAGCAAGAGTCTGT 10115670
chr7 135336556 rs57735959 G GCCTGGGCAACAGAGCAAGAGTCTGT 10115671

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results