Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 135645345 135658207 enh10057

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 135648743 rs187860504 C T 10117731
chr7 135648751 rs140782962 TATAAAGAAAGACTATCAAA T 10117732

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results