Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 136014805 136023975 enh102105

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 136016228 rs138325401 GAATATTTTTTCTACCTCGTACTTTCTCCAA G 10119672
chr7 136016228 rs71654913 GAATATTTTTTCTACCTCGTACTTTCTCCAA G 10119673

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results