Chrom Start End Enhancer ID Tissues that enhancer appears More
chr13 114147699 114148153 vista17160

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr13 114147866 rs142087083 TGTGTACTTAAAGTTGTACAC T 3411048

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results