EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr1:118301328-118301804]
Chromosome characteristics of ZZZ3[chr1:118301328-118301804]
Back to top
Enhancers possibly regulated by ZZZ3[chr1:118301328-118301804]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 118299565 118303715 enh110654
Cervix (HeLa-S3)
SNP sites on ZZZ3[chr1:118301328-118301804]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 118301361 rs139042469 AGAGGTGACAAGGATTCGCCCT A 597711
chr1 118301361 rs57060161 AGAGGTGACAAGGATTCGCCCT A 597712
chr1 118301429 rs10923415 T C 597713
chr1 118301434 rs530595830 G A 597714
chr1 118301575 rs379058 T A 597715
chr1 118301651 rs535722340 C T 597716
chr1 118301787 rs569471475 C G 597717
Genes possibly regulated by ZZZ3[chr1:118301328-118301804]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr1:118301328-118301804]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results