Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 166670925 166675510 enh90731

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 166673831 rs201477832 ATGTATATGGGGTGGAGCATAGG A 698108
chr1 166673831 rs57382952 ATGTATATGGGGTGGAGCATAGG A 698109
chr1 166673856 rs10918567 T C 698110
chr1 166673885 rs55872343 G A,T 698111
chr1 166674002 rs534575724 A G 698112
chr1 166674003 rs372407155 C T 698113
chr1 166674052 rs375431733 G A 698114

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results