EnhancerDB
  1. Home
  2. TFBS
  3. ZNF217[chr1:186181847-186182037]
Chromosome characteristics of ZNF217[chr1:186181847-186182037]
Back to top
Enhancers possibly regulated by ZNF217[chr1:186181847-186182037]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 186179725 186184595 enh27323
Brain (SK-N-MC) Astrocyte Muscle (A673) Spleen Epithelial (MCF-7)
SNP sites on ZNF217[chr1:186181847-186182037]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 186181848 rs537276944 T TTCC 797784
chr1 186181907 rs530755683 A AAAGCAAGCATGAGAGCATGCTTGT 797785
chr1 186182019 rs35325691 G A 797786
chr1 186182024 rs35600580 C CTG 797787
chr1 186182024 rs72079426 C CTG 797788
chr1 186182027 rs186233974 A G 797789
Genes possibly regulated by ZNF217[chr1:186181847-186182037]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF217[chr1:186181847-186182037]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results