EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:204680558-204680882]
Chromosome characteristics of ZNF274[chr1:204680558-204680882]
Back to top
Enhancers possibly regulated by ZNF274[chr1:204680558-204680882]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 204671389 204688135 enh890
Bone Marrow (K562) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Esophagus Blood (OCI-LY7) Placenta Peripheral Blood (MM.1S) Blood (Karpas-422) Lung (PC-9) Thymus Epithelial (MCF-7)
SNP sites on ZNF274[chr1:204680558-204680882]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 204680577 rs6696501 C T 878429
chr1 204680586 rs113095807 C A,T 878430
chr1 204680701 rs12133037 C T 878431
chr1 204680802 rs193198509 C G 878432
chr1 204680817 rs116439622 T C 878433
chr1 204680855 rs6696790 C T 878434
chr1 204680870 rs577989796 T TCATCCCTATACCCCACAAA 878435
chr1 204680879 rs145703406 T C 878436
Genes possibly regulated by ZNF274[chr1:204680558-204680882]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:204680558-204680882]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results