EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:212685263-212686413]
Chromosome characteristics of ZNF274[chr1:212685263-212686413]
Back to top
Enhancers possibly regulated by ZNF274[chr1:212685263-212686413]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 212683965 212696315 enh12643
Bone Marrow (K562) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Astrocyte Placenta Lung (PC-9) Pancreas Pancreas (Panc1)
SNP sites on ZNF274[chr1:212685263-212686413]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 212685319 rs578029309 G A 923546
chr1 212685366 rs183281394 C T 923547
chr1 212685443 rs528688899 T C 923548
chr1 212685673 rs145380527 G A,T 923549
chr1 212685749 rs72649990 C T 923550
chr1 212685875 rs74140032 C G,T 923551
chr1 212685912 rs28462080 T G 923552
chr1 212685928 rs28460233 C T 923553
chr1 212686101 rs557343319 A G,T 923554
chr1 212686262 rs549826819 T TGGCTGACCCAGCTGGGGAG 923555
chr1 212686395 rs371015523 G C 923556
Genes possibly regulated by ZNF274[chr1:212685263-212686413]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:212685263-212686413]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results