EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:212686255-212686669]
Chromosome characteristics of ZNF274[chr1:212686255-212686669]
Back to top
Enhancers possibly regulated by ZNF274[chr1:212686255-212686669]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 212683965 212696315 enh12643
Bone Marrow (K562) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Astrocyte Placenta Lung (PC-9) Pancreas Pancreas (Panc1)
SNP sites on ZNF274[chr1:212686255-212686669]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 212686262 rs549826819 T TGGCTGACCCAGCTGGGGAG 923555
chr1 212686395 rs371015523 G C 923556
chr1 212686561 rs542491950 T C 923557
Genes possibly regulated by ZNF274[chr1:212686255-212686669]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:212686255-212686669]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results