EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr1:221570595-221571099]
Chromosome characteristics of ZZZ3[chr1:221570595-221571099]
Back to top
Enhancers possibly regulated by ZZZ3[chr1:221570595-221571099]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 221563720 221573215 enh12691
Prostate (PC-3) Cervix (HeLa-S3) Prostate (RWPE1) Esophagus Astrocyte Placenta Lung (PC-9) Breast Spleen Epithelial (MCF-7)
SNP sites on ZZZ3[chr1:221570595-221571099]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 221570860 rs568748218 T G 965034
chr1 221570965 rs572043189 AG A 965035
chr1 221571001 rs1599084 C T 965036
chr1 221571015 rs181651786 C T 965037
chr1 221571027 rs187330389 G A 965038
chr1 221571084 rs545829648 CAATTGTAGAGCCCCAGGGCCTTGAGTG C 965039
Genes possibly regulated by ZZZ3[chr1:221570595-221571099]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr1:221570595-221571099]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results