EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr1:226663021-226663491]
Chromosome characteristics of ZNF143[chr1:226663021-226663491]
Back to top
Enhancers possibly regulated by ZNF143[chr1:226663021-226663491]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 226659281 226671155 enh970
Prostate (PC-3) Brain (SK-N-SH) Large Intestine Muscle (A673) Blood (Karpas-422) Lung (PC-9) Epithelial (MCF-7)
SNP sites on ZNF143[chr1:226663021-226663491]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 226663028 rs564013152 A C 992366
chr1 226663070 rs545354548 C G,T 992367
chr1 226663071 rs150547685 G A 992368
chr1 226663091 rs12086631 A G 992369
chr1 226663114 rs568252544 C T 992370
chr1 226663400 rs549038809 CCAGATGTCACTGGGTGAGAGGGAGAAAA C 992371
chr1 226663410 rs557753796 C T 992372
Genes possibly regulated by ZNF143[chr1:226663021-226663491]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr1:226663021-226663491]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results