Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 233593036 233597820 enh86839

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 233597445 rs74794487 G A 1035961
chr1 233597532 rs34077518 A G 1035962
chr1 233597589 rs4649228 G A 1035963
chr1 233597632 rs146998547 A G 1035964
chr1 233597637 rs4649229 G T 1035965
chr1 233597730 rs66783455 G A 1035966
chr1 233597734 rs376633682 GATGCCATCAGAGCCAGAGGA G 1035967
chr1 233597754 rs61824153 A G 1035968
chr1 233597818 rs35981407 G A,T 1035969
chr1 233597871 rs55899131 A G 1035970
chr1 233597948 rs190610252 G A 1035971
chr1 233598010 rs56355093 G A 1035972
chr1 233598078 rs543630353 C T 1035973
chr1 233598134 rs143386596 T C 1035974
chr1 233598199 rs143971517 C T 1035975
chr1 233598252 rs115448092 A T 1035976

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results