Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 233593036 233597820 enh86839

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 233597532 rs34077518 A G 1035962
chr1 233597589 rs4649228 G A 1035963
chr1 233597632 rs146998547 A G 1035964
chr1 233597637 rs4649229 G T 1035965
chr1 233597730 rs66783455 G A 1035966
chr1 233597734 rs376633682 GATGCCATCAGAGCCAGAGGA G 1035967
chr1 233597754 rs61824153 A G 1035968
chr1 233597818 rs35981407 G A,T 1035969
chr1 233597871 rs55899131 A G 1035970

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results