EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB33[chr1:234731087-234732149]
Chromosome characteristics of ZBTB33[chr1:234731087-234732149]
Back to top
Enhancers possibly regulated by ZBTB33[chr1:234731087-234732149]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 234731749 234739762 enh992
Bone Marrow (K562) Liver (HepG2) Cervix (HeLa-S3) Brain (SK-N-SH) Prostate (RWPE1) Blood (T-cell) Astrocyte Bone (Osteoblast) Blood (GM12878) Placenta Colon (HCT116) Blood (Karpas-422) Muscle (Myoblast) Muscle (Myotube) Thymus
SNP sites on ZBTB33[chr1:234731087-234732149]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 234731253 rs192219513 T C 1043852
chr1 234731309 rs74354752 T C 1043853
chr1 234731536 rs147037893 G A 1043854
chr1 234731575 rs528467387 C CCTGAAGCCTCCCGAGGAAACCAG 1043855
chr1 234731587 rs189856139 C A 1043856
chr1 234731760 rs117457139 A G 1043857
chr1 234731961 rs577536081 T C 1043858
chr1 234731989 rs10797556 G A 1043859
chr1 234732005 rs563336049 A T 1043860
chr1 234732022 rs75086092 G A 1043861
chr1 234732072 rs72749953 C T 1043862
chr1 234732114 rs116157069 C T 1043863
chr1 234732136 rs142910751 C A 1043864
Genes possibly regulated by ZBTB33[chr1:234731087-234732149]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB33[chr1:234731087-234732149]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results