Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 234731253 rs192219513 T C 1043852
chr1 234731309 rs74354752 T C 1043853
chr1 234731536 rs147037893 G A 1043854
chr1 234731575 rs528467387 C CCTGAAGCCTCCCGAGGAAACCAG 1043855
chr1 234731587 rs189856139 C A 1043856
chr1 234731760 rs117457139 A G 1043857

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results