EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:234839326-234839734]
Chromosome characteristics of ZNF274[chr1:234839326-234839734]
Back to top
Enhancers possibly regulated by ZNF274[chr1:234839326-234839734]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 234827105 234875936 enh12795
Bone Marrow (K562) Liver Astrocyte Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Kidney Skin (Keratinocyte) Stomach Brain (SK-N-SH) Ovary Bone (Osteoblast) Blood (OCI-LY7) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
SNP sites on ZNF274[chr1:234839326-234839734]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 234839344 rs145393078 C T 1045232
chr1 234839417 rs116815668 C T 1045233
chr1 234839451 rs534979232 G A 1045234
chr1 234839564 rs545591918 C CT 1045235
chr1 234839567 rs150516149 G GACA,GAGGGATCAGGGATAGAGTGACA,GATAGAGTGACA 1045236
chr1 234839578 rs547651481 G A 1045237
chr1 234839705 rs599129 T C 1045238
Genes possibly regulated by ZNF274[chr1:234839326-234839734]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:234839326-234839734]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results