| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr1 | 234827105 | 234875936 | enh12795 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr1 | 234839344 | rs145393078 | C | T | 1045232 | |
| chr1 | 234839417 | rs116815668 | C | T | 1045233 | |
| chr1 | 234839451 | rs534979232 | G | A | 1045234 | |
| chr1 | 234839564 | rs545591918 | C | CT | 1045235 | |
| chr1 | 234839567 | rs150516149 | G | GACA,GAGGGATCAGGGATAGAGTGACA,GATAGAGTGACA | 1045236 | |
| chr1 | 234839578 | rs547651481 | G | A | 1045237 | |
| chr1 | 234839705 | rs599129 | T | C | 1045238 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|