Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 92722885 92733795 enh28349
chr10 92731604 92731862 vista8294

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 92731445 rs545778521 CACTCCGGCCTGGGCGACAGTGAG C 1574827
chr10 92731580 rs149675691 A T 1574828
chr10 92731717 rs145455752 C T 1574829
chr10 92731759 rs545732069 A G 1574830

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results