Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 99520685 99526495 enh60270

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 99522715 rs550106910 A G 1605876
chr10 99522764 rs566072979 CCTCCGGCCTGGTCGGGTATGTTTCAA C 1605877
chr10 99522794 rs576832466 CCCAGAGCAGCACA C 1605878
chr10 99522803 rs566566165 G C 1605879
chr10 99522807 rs533613374 A C 1605880
chr10 99522849 rs75991462 C A 1605881
chr10 99522885 rs12244127 G A 1605882

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results