Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 99520685 99526495 enh60270

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 99522764 rs566072979 CCTCCGGCCTGGTCGGGTATGTTTCAA C 1605877
chr10 99522794 rs576832466 CCCAGAGCAGCACA C 1605878
chr10 99522803 rs566566165 G C 1605879
chr10 99522807 rs533613374 A C 1605880
chr10 99522849 rs75991462 C A 1605881
chr10 99522885 rs12244127 G A 1605882
chr10 99522941 rs142773256 A AC 1605883
chr10 99522945 rs182208302 C T 1605884
chr10 99522954 rs115523656 A G 1605885
chr10 99522971 rs117613804 A G 1605886
chr10 99523005 rs59403844 G A,T 1605887
chr10 99523224 rs184080755 G A 1605888
chr10 99523246 rs35404815 GTA G 1605889
chr10 99523246 rs397711564 GTA G 1605890

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results