Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 12660698 12665921 enh43494

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 12663578 rs548916737 C G 1858707
chr11 12663583 rs565029294 GTT G 1858708
chr11 12663586 rs562659288 T A,C 1858709
chr11 12663607 rs567418648 GCTAAAAAGAGGCCTGGTAGGATCACAGTCAACT G 1858710
chr11 12663693 rs138302086 A G 1858711
chr11 12663738 rs12295622 T C 1858712
chr11 12663834 rs112080747 C T 1858713

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results