Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 12660698 12665921 enh43494

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 12663607 rs567418648 GCTAAAAAGAGGCCTGGTAGGATCACAGTCAACT G 1858710
chr11 12663693 rs138302086 A G 1858711
chr11 12663738 rs12295622 T C 1858712

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results