Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 64265785 64272875 enh50856

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 64267875 rs77842009 C G 2040755
chr11 64267938 rs1529910 G A 2040756
chr11 64267948 rs6591856 A C 2040757
chr11 64268027 rs118090731 T C 2040758
chr11 64268127 rs145144661 G T 2040759
chr11 64268272 rs532758739 CACT C 2040760
chr11 64268277 rs530187434 ATCT A 2040761
chr11 64268439 rs67041191 GCCGGCTGGGCCTGCTTGTGGGTAAGGGAGAGAGGACAGAAGCCTGTGCTGCTCAGGAGCC G 2040762
chr11 64268456 rs531424310 G A 2040763

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results