EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr11:70092304-70093002]
Chromosome characteristics of ZNF143[chr11:70092304-70093002]
Back to top
Enhancers possibly regulated by ZNF143[chr11:70092304-70093002]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 70084795 70096615 enh14045
Prostate (PC-3) Large Intestine Astrocyte Bone (Osteoblast) Placenta Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Epithelial (MCF-7)
SNP sites on ZNF143[chr11:70092304-70093002]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 70092345 rs77629322 C T 2082183
chr11 70092420 rs113149620 G A 2082184
chr11 70092481 rs34858842 A G 2082185
chr11 70092493 rs547573025 C G 2082186
chr11 70092590 rs78964778 G A 2082187
chr11 70092599 rs114556976 G C,T 2082188
chr11 70092600 rs193008704 G C 2082189
chr11 70092633 rs75370953 G A 2082190
chr11 70092673 rs376429745 G C 2082191
chr11 70092698 rs376376693 C CCCAAAGAGAAAGGGATGGGA 2082192
chr11 70092698 rs555849671 C CCCAAAGAGAAAGGGATGGGA 2082193
chr11 70092702 rs78180736 A G 2082194
chr11 70092801 rs117873576 C A,T 2082195
chr11 70092802 rs28649212 G A 2082196
chr11 70092880 rs184740135 C T 2082197
Genes possibly regulated by ZNF143[chr11:70092304-70093002]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr11:70092304-70093002]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results