Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 110196634 110202515 enh80027

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 110199066 rs146420311 C A 2255405
chr11 110199089 rs536020456 C G 2255406
chr11 110199122 rs55737543 G T 2255407
chr11 110199269 rs1676527 G A 2255408
chr11 110199380 rs117975365 G A 2255409
chr11 110199667 rs116966871 A G 2255410
chr11 110199740 rs560184817 T G 2255411
chr11 110199852 rs577664820 T TCTTC 2255412
chr11 110199953 rs77499058 A G 2255413
chr11 110199982 rs113177402 C G 2255414
chr11 110200001 rs377588673 TCC T 2255415
chr11 110200163 rs61900229 C T 2255416
chr11 110200377 rs559825071 TCCTGAGGCTGCACAAGGCAGTGGGGC T 2255417
chr11 110200420 rs369698906 A T 2255418

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results