Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 113550065 113554615 enh90915

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 113552096 rs570088218 A ACCACCCAGGCCCACCCAGGCCCACCCAGG 2273645
chr11 113552118 rs139803733 G A 2273646
chr11 113552127 rs184006269 G A 2273647
chr11 113552151 rs543806838 C T 2273648
chr11 113552234 rs7116612 G A 2273649
chr11 113552290 rs76796806 G A 2273650
chr11 113552318 rs7925033 T C 2273651
chr11 113552319 rs74834015 G A 2273652

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results