EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr12:46571550-46572234]
Chromosome characteristics of ZZZ3[chr12:46571550-46572234]
Back to top
Enhancers possibly regulated by ZZZ3[chr12:46571550-46572234]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 46565860 46575755 enh86935
Epithelial (MCF-7) Blood (T-cell) Blood (GM12878)
chr12 46571692 46571878 vista13212
VISTA
SNP sites on ZZZ3[chr12:46571550-46572234]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 46571679 rs140616001 A G 2602139
chr12 46571682 rs116499836 A C 2602140
chr12 46571767 rs12317623 A C 2602141
chr12 46572044 rs539705203 C CA 2602142
chr12 46572090 rs555156110 CGTTGGGGGAAAGTGAGAGG C 2602143
chr12 46572138 rs146955566 A C 2602144
chr12 46572144 rs114797185 A G 2602145
chr12 46572165 rs556383752 G GC 2602146
Genes possibly regulated by ZZZ3[chr12:46571550-46572234]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr12:46571550-46572234]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results