Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 46565860 46575755 enh86935

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 46572044 rs539705203 C CA 2602142
chr12 46572090 rs555156110 CGTTGGGGGAAAGTGAGAGG C 2602143
chr12 46572138 rs146955566 A C 2602144
chr12 46572144 rs114797185 A G 2602145
chr12 46572165 rs556383752 G GC 2602146
chr12 46572249 rs935237 G A 2602147

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results