Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 56037782 56046995 enh14750

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 56040066 rs79728885 A G 2655734
chr12 56040079 rs139604479 T C 2655735
chr12 56040125 rs114317194 A G 2655736
chr12 56040201 rs77625892 G C 2655737
chr12 56040225 rs145003152 C T 2655738
chr12 56040277 rs11171636 A C 2655739
chr12 56040387 rs11171637 A G 2655740
chr12 56040401 rs11171638 C T 2655741
chr12 56040471 rs147570825 T A 2655742
chr12 56040521 rs536710592 C G 2655743
chr12 56040552 rs543780073 A AGCAGGAAAGCTGTGGGAGAGGCC 2655744
chr12 56040576 rs548625814 A G 2655745

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results