Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 112348925 112355175 enh2605

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 112354466 rs550416322 A AACTCCCAACCTCAGGTGAT 2904032
chr12 112354486 rs572258978 C A 2904033
chr12 112354524 rs540640881 C G 2904034
chr12 112354531 rs7294902 T C 2904035
chr12 112354658 rs185435514 T C 2904036
chr12 112354740 rs535864958 C A,G 2904037

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results