Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 115147565 115153575 enh15008

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 115150801 rs111509229 T C 2914578
chr12 115150831 rs571379638 TCAGCCTCCCAAGTAGCTGGGACTA T 2914579
chr12 115150889 rs571125638 G A 2914580
chr12 115151015 rs372464785 C T 2914581
chr12 115151073 rs11829215 A G 2914582
chr12 115151090 rs145672682 C T 2914583
chr12 115151153 rs12302620 G T 2914584
chr12 115151156 rs11829223 A G 2914585
chr12 115151188 rs117130404 C A 2914586

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results