EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr14:50017583-50017843]
Chromosome characteristics of ZZZ3[chr14:50017583-50017843]
Back to top
Enhancers possibly regulated by ZZZ3[chr14:50017583-50017843]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 50009905 50019755 enh51811
Lung (PC-9) Cervix (HeLa-S3) Large Intestine Epithelial (MCF-7)
SNP sites on ZZZ3[chr14:50017583-50017843]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 50017653 rs181905860 T C 3525148
chr14 50017691 rs114806304 A G 3525149
chr14 50017806 rs562153697 C G 3525150
chr14 50017836 rs148660852 T TCA,TCACACACA,TCACACACACACA 3525151
chr14 50017836 rs58389653 T TCA,TCACACACACACACACACACA 3525152
chr14 50017836 rs767461415 T TCA 3525153
Genes possibly regulated by ZZZ3[chr14:50017583-50017843]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr14:50017583-50017843]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results