Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 52581685 52587995 enh15612

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 52583564 rs114437525 T C 3540735
chr14 52583761 rs11390140 T TG 3540736
chr14 52583798 rs116507090 T C 3540737
chr14 52583835 rs547839995 AACTTTTTATTATGGAAGAGTTCAAGCAAAT A 3540738
chr14 52583847 rs577008570 T C 3540739
chr14 52583878 rs74679132 A G 3540740
chr14 52583882 rs556378236 T C 3540741
chr14 52583970 rs140707328 C T 3540742

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results