Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 53573225 53579090 enh3193
chr14 53575786 53575939 vista17794

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 53575890 rs34662376 TC T 3545694
chr14 53575890 rs796729162 TC T 3545695
chr14 53575911 rs552010182 C T 3545696
chr14 53576051 rs10130532 C T 3545697
chr14 53576138 rs185016491 T C 3545698
chr14 53576140 rs560075888 A ATTTTCTAGTCTCCTATTTTCTC 3545699
chr14 53576163 rs141592338 C T 3545700
chr14 53576230 rs113790256 T C 3545701

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results