Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 64027185 64034415 enh15666

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 64032159 rs140940917 G A 3600880
chr14 64032195 rs374049222 G A 3600881
chr14 64032212 rs116715241 T C 3600882
chr14 64032246 rs560224106 AAGCAAGTGTCAGAGGATGGAATTTTCCATTGCGAGTATGTCTGGGC A 3600883
chr14 64032249 rs7143992 C T 3600884
chr14 64032271 rs536480328 T C 3600885
chr14 64032310 rs7145363 T C 3600886
chr14 64032348 rs144860585 C T 3600887
chr14 64032373 rs116119302 G A 3600888
chr14 64032504 rs140403052 TA T 3600889
chr14 64032548 rs7145769 T C 3600890
chr14 64032563 rs116529171 G T 3600891

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results