EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr14:64217249-64217689]
Chromosome characteristics of ZNF274[chr14:64217249-64217689]
Back to top
Enhancers possibly regulated by ZNF274[chr14:64217249-64217689]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 64210729 64223135 enh3280
Prostate (PC-3) Cervix (HeLa-S3) Prostate (RWPE1) Blood (OCI-LY7) Blood (GM12878) Placenta Peripheral Blood (MM.1S) Blood (Karpas-422) Muscle (Myoblast)
SNP sites on ZNF274[chr14:64217249-64217689]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 64217349 rs368224234 TG T 3602143
chr14 64217394 rs138501852 ATTAT A 3602144
chr14 64217412 rs75413955 T C 3602145
chr14 64217498 rs551115516 TTTCTATCGTTTTACTTTACCACTAA T 3602146
chr14 64217512 rs549891422 C T 3602147
chr14 64217545 rs566629660 C CT 3602148
chr14 64217612 rs569749492 T C 3602149
chr14 64217626 rs112147343 T A 3602150
Genes possibly regulated by ZNF274[chr14:64217249-64217689]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr14:64217249-64217689]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results